產(chǎn)品名稱 |
Komagataella phaffii Kurtzman |
商品貨號(hào) |
B207704 |
Deposited As |
Komagataella pastoris |
Strain Designations |
NRRL Y-11430 [21-1, CBS 7435] |
Application |
Produces alcohol oxidase. Produces single-cell protein SCP. |
Biosafety Level |
1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
Product Format |
freeze-dried |
Storage Conditions |
Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
Type Strain |
no |
Preceptrol® |
no |
Genome Sequenced Strain |
Yes
|
Comments |
Genome sequencing strain (The Institute of Molecular Biotechnology, Graz University of Technology, Austria).
Mitochondrial genome sequenced (The Institute of Molecular Biotechnology, Graz University of Technology, Austria). |
Morphology |
On YM medium at 25°C after 8 days, colonies creamy white, butyrous, dull, smooth, margin entire. Cells hyaline, globose to subglobose, smooth, 3-7 X 3-6 μm. Pseudohyphae not observed. |
Medium |
ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
|
Growth Conditions |
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic |
Sequenced Data |
Internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence
TAAATCTCCTCCCAACGGATCTCTTGGCTCTCGCGACGATGAAGAACGCAGCGATCCGCGATACGTCCTGGAAGCCGCCGTGAACCATCAATTTTCGAACGCACATTGCATACAGGGAGGGTGGGGTGAGTCTACTCTCACTATCGTGGTTTAAATACAAAGGATGACTAATACAATCGTCAGCCCCCAAATTTTCTCCCCCGCCCCCTCAGATTACCCGCTGAACTTAAGCATATCAATAA
D1D2 region of the 26S ribosomal RNA gene
ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGTCCACCTTTGAAGTATTGACGTGGTTGGGAGAGGCAATGTGCACAAGTCGCCTGGAACGGCCGCCAAAGAGGGTGATAGCCCCGTAGCACGGTCAACCTTCCCAGCCGACAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAAGGTGGTAGGGTCCATCAAAGACTAAATATCAGCGAGAGACCGATAGCAAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAACAGTGCGTGAAATTGGGGGGAGGGAAGGCAAGGCCACGACAAGTGGTCCTGCGC
|
Name of Depositor |
NRRL |
Chain of Custody |
ATCC <-- NRRL <-- Phillips Petroleum Co. 21-1 |
References |
Wegner EH. Biochemical conversions by yeast fermentation at high cell densities. US Patent 4,617,274 dated Oct 14 1986
Hopkins TR. Alcohol oxidase from Pichia-type yeasts. US Patent 4,619,898 dated Oct 28 1986
Kuberl A, et al. High-quality genome sequence of Pichia pastoris CBS7435. J. Biotechnol. 20;154(4): 312-320,2011. PubMed: 21575661
Kurtzman CP. Biotechnological strains of Komagataella (Pichia) pastoris are Komagataella phaffii as determined from multigene sequence analysis. J Ind Microbiol Biotechnol 36: 1435-1438, 2009. PubMed: 19760441
|